josefinaneedstosleep josefinaneedstosleep
  • 22-05-2023
  • Social Studies
contestada

“the history of all hitherto existing society is the history of class struggles”
what is a marxist principle that the above quote helps to explain

Respuesta :

Otras preguntas

Compared to mitosis, meiosis results in greater... A)amount of cell cytoplasm per cell B)number of daughter cells per cell C)amount of genetic material per cell
A department store purchases a dress for $80. To sell the dress to customers, the price is marked up by 19%. You hand the clerk $110. How much change will you
A red dwarf is _____ A. the remains of a supernova. B. a hot pulsar. C
Does old age means end of life according to A Tennyson in Ulysses
Joe has eaten 3/5 of a pizza. Jane has eaten 1/7 of a pizza. How many times more pizza has Joe eaten than Jane in an improper fraction?
Sound travels at a rate of 340 m/s in all directions through air. Matt rings a very loud bell at one location, and Steve hears it some time later at his locatio
what stress force on a reverse fault?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
what procedure could you use to test the effect of a catalyst on a reaction
Animals with cephalization usually have Select one: A. radial symmetry B. only 2 germ layers C. bilateral symmetry D. a digestive cavity with a single opening