Daisysolis3554 Daisysolis3554

25-01-2024
Chemistry

contestada

why are chromium oxide (Cr₂O₃) and manganese oxide (Mn₃O₄r) educed by aluminium metal power instead of carbon?

Respuesta :

Otras preguntas

Joe made 15 points in a basketball game, 3 points are given for a long shot, 2 points given for a field goal, and 1 point is given for a free throw. In how many

which of the following does NOT describe the process of summation? a. Two ESPSs are generated at the same time by two separate synapses, bringing the cell to th

. The production of fatty acids is dependent on bicarbonate, but radioactive bicarbonate is not incorporated into the new fatty acid. What could be the reason f

how did Thomas Edison contribute to the Industrial Revolution

What is a vestigial organ

1.True or false: It may be possible to save a significant proportion of Earth's biological diversity by establishing sustainable biological reserves at 25 locat

Tell whether the given value is a solution to the inequality. -2.4m>-6.8;m=-3

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

A carton measures 3 feet by 2 feet by 2 feet. A machine can fill the carton with packing material in 3 seconds. How long would it take to fill a carton that mea

When parietal cells secrete protons into the stomach, what would you predict would happen to the pH of the blood? Would this process be affected if you treated