gngtp8843 gngtp8843
  • 26-03-2024
  • Chemistry
contestada

Consider a reaction A(g) → 2B(g) + C(g) Initial pressure (Pi) = 800 mm Hg. At 10 minutes, total pressure is 1600 mm Hg, then find the total pressure at 30 minutes. (in mm Hg)

Respuesta :

Otras preguntas

What is 2(-5 + 3) as an equivalent expression. What is the value of the expression?
The sum of z and 2.5 is the same as the 5.2 more than 3.2z. Find z.
Urgent assignment! Quarter of grade Pre-Algebra
name 4 stars of different sizes in order from largest to smallest​
10. Site-to-Site VPN architecture is also known as a) Remote connection based VPNs b) Peer-to-Peer VPNs c) Extranet based VPN d) Country-to-country VPNs
Find the set of values of x for which both y2 - 7x+6 >= 0 and 2x + 7 >= 1​
HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT
What did Teodore Roosevelt do at the Spanish American War?
Which statement is an example of an opinion?
7x +14y =28 5x + 10y =20