xtftjp68sr xtftjp68sr
  • 21-04-2024
  • Mathematics
contestada

If the mean of the data is 3 chicken nuggets of 1, 3, 0, 6?

Respuesta :

Otras preguntas

How do you know whether to put a nine or a 10 in front of the number on the weather station
Which current flows south along the west coast of the u.s.?
What strategies did both césar chávez and the ufwoc use to achieve their goals? how did they successfully apply these tactics?
The term ____ means making an organization ready for possible contingencies that can escalate to become disasters.
x = a) 20 b) 60 c) 100
Dimitri and rita eat some donuts for breakfast and then spend the morning at an amusement park. after a few hours of riding the super looper double twist dimitr
A mí me gusta beber _____. A. las salchichas B. las galletas C. los tocinos D. los refrescos
The graph shows that the world’s coal reserves are disappearing evenly distributed not measurable unevenly distributed . The higher coal reserves in Asia and Oc
PLEASE HELP!!!! What is the range of the data set? 68 88 113 156 113 210 145
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt