dyala004 dyala004

25-05-2024
Mathematics

contestada

When the lock is full, the water in the lock of a canal fills a rectangular solid of dimensions 700 ft long, 150 ft wide, and 45 ft deep. There are 7.48 gal of water in each cubic foot. How many gallons of water are in the lock?

Respuesta :

Otras preguntas

A 54.2 L sample of gas at 115 K is heated to 345 K, at constant pressure. What volume does the gas now occupy?

statement and reasons m<1 +m<2+ m<3=180 whats the reason?

How are glial cells and neurons alike and how are they different. Give 3 sentences for each

This is Super Confusing to me

What two cell types do complement proteins interact with, besides the pathogen itself?

Why would Congress not seat newly elected senators and representatives from southern states?

(Does this represent a linear function) (3,6)(0,2)(3,5)

What type of triangle is this?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Joe has eaten 3/5 of a pizza. Jane has eaten 1/7 of a pizza. How many times more pizza has Joe eaten than Jane in an improper fraction?