jelsaislife1215 jelsaislife1215

24-07-2018
Physics

contestada

Which substance is a mixture?

salt

gasoline

aluminum

carbon dioxide

Respuesta :

durekhan123 durekhan123

31-07-2018

gasoline is a answer of question

Answer Link

Otras preguntas

A storage unit is in the shape of a cube with 8 feet edge lengths what is the surface area of the storage unit

Identify the parts of the human body that normally contain bacteria

write a sentence using the words limiting factor and carrying capacity

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Consider the following formula used to find the volume of a cone. Which of the following represents the formula that could be used to find the height of the con

Mantle convection is a circulation of heat emitted by the earths... A) core B) crust C) lithosphere D) atmosphere

The chorionic villi of the placenta develop a series of capillaries that are immersed in lacunae of the mother's blood for exchange into the embryo's blood duri

which of the following was a justification for the increase in US defense spending during the Cold War

explain the conditions for cloud formation

Which lines in this excerpt from Mary Otis Warren's poem "A Political Reverie" use figurative language? I look with rapture at the distant dawn , And view the g