BetsyH
BetsyH
22-09-2018
Mathematics
contestada
Help me, I don't get it
Respuesta :
catherinezeffer
catherinezeffer
22-09-2018
subtract the number to find it’s difference. difference always means subtract
Answer Link
VER TODAS LAS RESPUESTAS ( 12+ )
Otras preguntas
J.P. Industries purchased 2,000 shares of Yang's common stock for $143,000 as a long-term investment. The investment is classified as available-for-sale securit
What major change, beginning on the late 1790s/1800s, using technological improvements, and taking advantage of large pool of immigrants, was starting in the Un
These two triangles have the same perimeter. solve for x.
__________is a legal umbrella covering protections that involve copyrights, trademarks, trade secrets, and patents for "creations of the mind" developed by peop
In the context of open market operations, when inflation is a concern, the Fed sells securities to buyers who write checks to the Fed to pay for securities they
a shop is having a sale all items are reduced by 30% work out the sale price of an item normally priced 110 pounds
Write the base sequence of the complementary strand of double-helical DNA in which one strand has the sequence (5)ATGCGTAGCCTAGCCTAGTAGCCTTC(3). What is RNA seq
Product planners need to think about products and services on three levels. The second level is where the company turns the core benefit into a(n) ________.
Dakota has \dfrac4{10} \text { kg} 10 4 kgstart fraction, 4, divided by, 10, end fraction, start text, space, k, g, end text of clay. He divides the clay to m
Suppose oil spills from a ruptured tanker and spreads in a circular pattern. If the radius of the oil spill increases at a constant rate of 2 m/s. How fast is t
