bri2192 bri2192
  • 25-09-2018
  • Mathematics
contestada

evaluate a÷b for a=10 and b=5

evaluate ab for a10 and b5 class=

Respuesta :

MitoSamaAnswers
MitoSamaAnswers MitoSamaAnswers
  • 25-09-2018

The answer is D. 10 divided by 5 is 2 because 5 times 2 is ten. Hope this helps you out :)

Answer Link
tamayalucas23 tamayalucas23
  • 25-09-2018

it D :) .........................

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Tell whether the given value is a solution to the inequality. -2.4m>-6.8;m=-3
people involved in cases that are accepted by the us supreme court must travel to washinton dc?
if you are given a 2% raise and inflation rate is 3% you are
Discuss the consequences of poor wound management.
what would you use chromatography for?
Which one of the following statements expresses a true proportion? A. 2 : 3 = 3 : 2 B. 3 : 5 = 12 : 20 C. 42 : 7 = 6 : 2 D. 14 : 6 = 28 : 18
This is Super Confusing to me
If the unit selling price is 2.50 and the unit cost is 1.00, what action is needed to maintain the gross margin percentage when unit cost increases 0.25?
Is 0.444444444444444... a rational number? explain is 0.35435543554... a rational number? explain