zairemann58 zairemann58

24-01-2019
Mathematics

contestada

Sarah and Angela have a collection of pennies and nickels in there piggy banks. Whitch girl has more coins in her bank explain how you know using numbers and symbols

Respuesta :

jashae2003 jashae2003

24-01-2019

Answer:

Angela has more coins

Step-by-step explanation:

173+105=278

and

149+127=276 ;278>276

Answer Link

Otras preguntas

What did the anti-federalist want? What did the federalist want?

A recipe that will make 5 pies calls for 8 cups of flour. Determine how many pies can be made with 48 cups of flour

please help me answer this question

Which of the following is/are example(s) of 'Growth play driven by thought leadership'? Select the option/s and click submit. (a) Radical business model transfo

Sorry for my computer screen! For each of the following angles, name the angle that is congruent. a. ZJ b. ZK=

In a double covalent bond, a carbon atom shares.

HELPPP PLEASEE!!!!!!!!!!!!!!!!!!!!!!!! Transcribe the following DNA strand: AAATACCCCGTAATGGCATAGGTCTGCACT

Which is most likely to result in an accident? planning ahead following instructions overlooking risks taking your time

Determine the measures of all the angles in each diagram

6.2 solving systems using substitution worksheet5x-5y=0y=4x+18