22-05-2019
Mathematics

contestada

Which point is a solution to y<4x+5

Respuesta :

Danutz98 Danutz98

22-05-2019

Answer:

(1,-1)

Step-by-step explanation:

y < 4x+5

x = 1, y = -1 => -1 < -4+5 (T)

Answer Link

Otras preguntas

help me to answer plz

Which of the following founders wrote the bill of rights? a. George mason b. James madison c. Benjamin franklin d. Alexander hamilton please select the best ans

please help:) will give brainliest

An individual’s ability to focus on a particular conversation in a noisy and crowded room is called:

Max is a newly licensed real estate agent. He gets a position with a brokerage firm that plans to pay him commissions, not a salary. What kind of contract might

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

What were two consequences of US involvement in World War I for German immigrants and their descendants?

Use of English Task 4. Complete the second sentence so that it has a similar meaning to the first. Use the words in brackets. Use 2–5 words, including the words

The teacher collected some snowfall data during one of the snow days last year. Estimate the total snowfall throughout the day.

Pls answer this question