fayehowarth53511 fayehowarth53511

24-07-2019
Spanish

contestada

Question 6 Esos _ (Those) chicos son (simpático), pero son _______(tonto).

Respuesta :

greycheckers greycheckers

24-07-2019

1) simpáticos
2) tontos

Answer Link

Otras preguntas

jon eat 3/4 of a pizza how much pizza is left

approximately how long does it take the moon to complete one orbit around earth

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

The heart sounds S1 and S2 are...?

If two solutions differ in their [H3O+] by a factor of 2.0, the difference in their pH will be 2.0.

How are vibrations different between bigger sizes rubber bands and smaller sized rubber bands?

plz help what is the answer.

A parking lot in the shape of a trapezoid has an area of 12,052.1 square meters. The length of one base is 82.4 meters, and the length of the other base is 108.

2. Students are asked to sequence the order of the seasons using picture cards. Which group of students sequenced their picture cards correctly? winter summer s

which of the following was a justification for the increase in US defense spending during the Cold War