hijjawi2004 hijjawi2004

21-04-2020
Health

contestada

What are the potential benefits of this product Zumba

Respuesta :

Jessicamcgarrahan Jessicamcgarrahan

21-04-2020

Answer:

it helps with sickness

Explanation:

Answer Link

Otras preguntas

What is the x-coordinate of the ordered pair for the solution of the system of equations {y = −x + 102x + 6y = 8?

Nicki needs to purchase at least 65 party decorations. The party palace charges $0. 50 per decorative streamer and $0. 25 per balloon, including tax. Which comb

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

You pull sideways on a 50 kg crate with a force of 450 n. There is also a 250 n frictional force on the box. What is the acceleration of the box?.

Which of the following is an example of a network layer (layer 3) protocol? IP, TCP, UDP, Ethernet

A small tropical fish is at the center of a water-filled spherical fishbowl 28.0 cm in diameter.a. Find the apparent position of the fish to an observer outside

discuss the continuity of the function. f(x, y) = sin(xy) xy , xy ≠ 0 1, xy = 0

a sinusoidal transverse wave is traveling on a string. any point on the string: a) moves in the same direction as the wave b) moves in simple harmonic motion wi

according to the text, what is the best or most likely reason an authoritarian regime might draft a constitution?

what is the sequence of a peptide based on the following mrna sequence? 5' . . . uuuucuuauugucuu 3'