helenirby1964 helenirby1964
  • 22-05-2020
  • Chemistry
contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof
  • 22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

factorization of 13x2 + 5x - 13x- 5 is
Suppose the price of gasoline in July 2004 averaged $1.35 a gallon and 15 million gallons a day were sold. In October 2004, the price averaged $2.15 a gallon an
Simplify each using positive exponents only: questions on image
Which of these statements qualify as an unexpected expense? Your buddy, who owns the coolest computer in the world, just bought a new one and wants to sell his
A(n) is made during research to tell the facts about the source one is using.
write an equation for the reaction in which hydrochloric acid neutralises sodium hydroxide​
Diego has a standard 52 card playing deck, which includes 13 heart cards, 13 spade cards, 13 diamond cards, and 13 club cards. If he draws one card at random, w
lus A B С D If AC = 18 and CD = 5, AD = [?] Enter
In what climate zone does St. Petersburg lie? Tundra Humid subtropical Humid continental Subarctic
describe how water molecules can hydrate various substances