theresa3549 theresa3549

22-05-2020
Mathematics

contestada

calculate the formula by using simultaneous equation

1: 2x+3y = -1
x+y = -1

Respuesta :

roxana24 roxana24

22-05-2020

I think that X = -2 and Y = 1

I hope my answer will serve you.

Answer Link

Otras preguntas

in dogs, wire hair (S) is dominant to smooth (s). Cross of a homozygous wire-haired dog with a smooth-haired dog and show the genotypic and phenotypic ratios.

Compare and contrast immune tolerance with licensing

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Which of the following is an example of a “smart” exercise choice? Wear extra layers of clothing Swim where a lifeguard can see Prepare large meals beforeha

write a sentence with the word labyrinth

Why wood suitable to build boats and rafts

The election of 1800 demonstrated that the Alien and Sedition Acts were constitutional. the electoral college worked smoothly. the US government was stable. pre

The physical environment (for example, our living spaces) that we, as individuals, create __________________. a. is unrelated to our communication b. reveals in

1+4 = 5. 2+5=12. 3+6=21 8+11==?

. The production of fatty acids is dependent on bicarbonate, but radioactive bicarbonate is not incorporated into the new fatty acid. What could be the reason f