lyrics92
lyrics92 lyrics92
  • 25-08-2020
  • Spanish
contestada

can someone fill in the blanks (ALL blanks spanish)

can someone fill in the blanks ALL blanks spanish class=

Respuesta :

ekerintador
ekerintador ekerintador
  • 25-08-2020

Answer:

1) una chica

3)  once

4) una

5) una amiga

7) hacer una descarga

Explanation:

Answer Link

Otras preguntas

How do I know if an equation is a function or not without actually graphing it
“The Bane of the Internet” is written in first-person subjective point of view, so the narrator _____. tells the story as it is happening tells the story as it
In a compound sentence, only the but conjunction may be replaced with a semicolon. True False
What figurative language does the narrator use to describe her life in "mother to son"??
A population of red squirrelfish breeds and produce offspring, 75% are still red but 25% are yellow. This variation in the color of the squirrelfish can be exp
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt
You are writing a story about a little boy's first visit to the dentist. Which MOST CLEARLY organizes your story to describe this experience? A) Compare his d
A (-1,5) B (0,6) D (0,2) Kite ABCD has the vertices shown. Find the coordinates of point C. A) (2, 5) B) (1, 5) C) (1, 4) D) (1, 6)
a change in one or a few nucleotides that occur at a single point in the DNA sequence
A park has a large circle painted in the middle of the playground area.thecircle is divided into 4 equal sections And each section is painted a different color.