nicolemlopez21 nicolemlopez21

22-09-2020
Mathematics

contestada

An irrational number between 4 and 7.

Respuesta :

serenitylaban808 serenitylaban808

22-09-2020

Answer: an irrational number between 4 and 7 would be 5

Step-by-step explanation:

Answer Link

Otras preguntas

Dimitri and rita eat some donuts for breakfast and then spend the morning at an amusement park. after a few hours of riding the super looper double twist dimitr

When congress rechartered the bank of the united states in 1832: the economy went into a depression jackson made nicholas biddle its new director western farmer

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

The temperature is less than 3.5°F. Write and graph the inequality

You are required to park within 12 inches of

What happens when the density of a medium increases? A. Bending of light decreases B. Bending of light increases C. Temperature of light increases D. Te

What is one essential element in the story of Echo that makes it a myth?

imagine you live only one mile from work and you decide to walk.if you walk four milesb per hour how long will it take you to walk one mile?

Tom atoe grows fruits and vegetables for home consumption. this activity is

Why is it important to measure perimeter and area