smithalaira640 smithalaira640

25-09-2020
Mathematics

contestada

Find the sum or difference:

-(2-x)-3(6+8x)-12

Please solve

Respuesta :

longr030 longr030

25-09-2020

Answer:

23x-32

Step-by-step explanation:

Answer Link

Otras preguntas

Which of these ordered pairs could you remove to make this relation a function? {(-2,1), (-1, -5), (-1,5), (0, -7), (2, 1)}

3 miles in 2.8 minutes;33.3 miles iin x

Wendy and Joyce had the same amount of money. Wendy spent $960 while Joyce spent $2,500. In the end, Wendy had 3 times as much money left as Joyce. How much mon

(We, Us) students begin our adventure at dawn.

The price of an item has been reduced by 70% the original price was $58 what’s the price of the item now ¿

How does the graph of g(x)=0.25⌊x⌋ differ from the graph of f(x)=⌊x⌋? 1. Multiplying by 0.25 compresses the graph of g(x)=0.25⌊x⌋ vertically by a fa

The ______ barred racial discrimination in virtually all areas of American life. Twenty-Third Amendment Twenty-Fourth Amendment Bill of Rights Civil Rights Act

A deep sea diver descends below the surface of the water at a rate of 60 ft each min. What is the depth of the diver after 9 min. Write an expression and solve.

ichelle bought 76 pounds of cocoa powder for her bakery. Every day she used the same amount of cocoa powder to make bakery items. After 10 days, Michelle was le

DNA tacaggtacccgaacccaattta