Seudónimo Seudónimo
  • 25-09-2020
  • Mathematics
contestada

pls help and explain why

pls help and explain why class=

Respuesta :

dylwright07 dylwright07
  • 25-09-2020
5 sided shapes are polygons
Answer Link
smolkajacob53 smolkajacob53
  • 25-09-2020
E is a polygon because it has 5 sides
Answer Link

Otras preguntas

list three words or phrases in a verbal problem that can be translated into an equals sign in equation
Odessa and Daxton are making a table that is 3 1/3m high and has an area of 32m2. What is the width?
What role did research play in developing the Talking Sex Together (TXT) campaign?​
Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I
A triangle is placed in a semicircle with a radius of 5cm. Find the area of the shaded region. Use the value 3.14 , and do not round your answer. Be sure to inc
Midori is buying raw almonds in bulk for a cake. She can buy 9 ounces for $12. Use the numbers in the box to complete the double number line that shows the unit
Line CE is the perpendicular bisector of segment FG
Which part of the cell contains organelles? A. Organelle B. Cell membrane C. Cytoplasm D. Nucleus
Theo Chocolate is considering opening a cooking school which will teach students techniques for working with chocolate and recipes that feature Theo chocolate a
Mga Antas ng tao sa Lipunan