olusojiesther8 olusojiesther8
  • 23-10-2020
  • Chemistry
contestada

How do planetary geologists study rocky planets?

Respuesta :

SweetTea16
SweetTea16 SweetTea16
  • 23-10-2020

Answer:

Planetary geologists study rocky planets by comparing them to Earth.

Explanation:

A planetary geologist is someone who studies how other planets form and evolve over time. Planetary geologists work in the field, laboratory, and -indirectly- in outer space through imagery and other data returned by spacecraft.

Please mark me the brainliest!?!

Answer Link

Otras preguntas

Which of the following is an example of a “smart” exercise choice? Wear extra layers of clothing Swim where a lifeguard can see Prepare large meals beforeha
Can you pleas help me solve this assignment?
How do I do this? tell me the answer and how you got it.....I have to graph this later
Which name does the monk who travels to the west not use
How can you use this document to argue that imperialism(colonization) was one underlying cause of world war I?
find the quotient of 3870 and 18
What molecule is responsible for determining the fate of each cell
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
If 1+4=5 what is 8+11
How do bones in a fossil survive for millions of years?