heidiarely1023 heidiarely1023
  • 25-10-2020
  • Mathematics
contestada

Prove angles XAP+YBP=APB
Help please

Prove angles XAPYBPAPB Help please class=

Respuesta :

devishri1977
devishri1977 devishri1977
  • 25-10-2020

Answer:

Step-by-step explanation:

H = ∠XAP    {alternate interior angles are congruent}

C =∠YBP      {Alternate interior angles are congruent}

∠APB = H + C

          = ∠XAP + ∠YBP

Answer Link

Otras preguntas

Which of the following can increase your credit cards APR
When a cell related to immunity activates only in reaction to a specific pathogen, it is called _____. (Points : 4) inducibility clonality lymphocytes T lymphoc
jon eat 3/4 of a pizza how much pizza is left
What makes for good scientific data
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
PLEASE HELP ME AASSAPP
which process do scientists think provided earth with an oxygen- rich atmosphere
A single stranded DNA has a base sequence of 5'GACTCCGTAACGGTTAACC3'.What DNA sequence will base pair
Mrs. Gannon is having her class make a winter decorations using pine cones. If each decoration needs 11 pine cones and Mrs. Gannon ha 18 students in her class.
Which of the following tactics do food manufacturers use to try to get you to buy their products? a. TV and radio commercials b. all of the above c. coupons d.