ccansino80p3110w
ccansino80p3110w ccansino80p3110w
  • 23-12-2020
  • Mathematics
contestada

what is the slipe of the line that passes through the two points (3,-4) and (5,8)​

Respuesta :

2024ZhaA
2024ZhaA 2024ZhaA
  • 23-12-2020

Answer:

m=6

Step-by-step explanation:

Using the slope formula-

m=8+4/5-3

m=12/2

m=6

Answer Link
kelvinhabakuk2 kelvinhabakuk2
  • 23-12-2020

Answer:

6

Step-by-step explanation:

slope =∆y

∆x

=8--4/5-3

=6

Answer Link

Otras preguntas

What does the Area under a Speed-time graph represent? A. acceleration B. average speed C. deceleration D. distance travelled
Society in every state is a blessing, but "government even in its best state is but a necessary evil; in its worst state an intolerable one"; for when we suffer
Linear gameplay is sometimes also known as “campaign mode” or what mode? A. skirmish mode B. battle mode C. story mode D. cyclical mode
Plssss help congruent triangles exercises .
As DNA replication continues and the replication bubble expands, the parental double helix is unwound and separated into its two component strands. a. True b. F
Which ethnicity makes up the majority of the US population? Asian Hispanic or Latino Black or African American White
Help help help help math math
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
A solution containing 0.60 moles of sodium hydroxide is added to excess magnesium sulfate in solution. A white solid, magnesium hydroxide, is formed.a) Write a
Please help 6 32 + (6 - 2) • 4 - 4 ] 3