N7ilahtos4hirlcon N7ilahtos4hirlcon
  • 24-10-2016
  • Mathematics
contestada

What is seven one fifth written as a percent?

Respuesta :

CaptainSmooth
CaptainSmooth CaptainSmooth
  • 25-10-2016
7 1/5 will be 514% or 5 hundred and 14% hope I helped
Answer Link

Otras preguntas

Imagine that you are managing a large wildlife preserve that was formerly a cattle ranch. You know from historical accounts that wild sheep used to live there,
How do different activities, such as running or swimming affect your breathing? How does sleeping affect your breathing?
Pb2O4 has a ratio of 2:4. It needs to be reduced to? A.) 1:0 B.) 2:0 C.) 1:2 D.) 2:2
4. A hotel receptionist greeted A (warm).​
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
PLS HEEEELP!!Describe the organization of the human body.
16. Which of the following situations is represented by the graph? A conversion of inches to yards B conversion of feet to inches c conversion of miles to feet
Rewrite the expression without parentheses. 13m−​(−9m−4​)
which statement best describes the distribution of human populations on the earth
who was the founder north carolina