clifford40 clifford40
  • 23-02-2021
  • Mathematics
contestada

4(3/4x-4)-13=7 what’s the answer

Respuesta :

monkeymanrules075
monkeymanrules075 monkeymanrules075
  • 23-02-2021

Answer:

=12

Step-by-step explanation:

4(34−4)−13=7

4(34−4)−13=7

Answer Link
alexanderperezii
alexanderperezii alexanderperezii
  • 23-02-2021
4(3/4x-4)-13=7

Distribute the 4.

3x-16-13=7

Add -16 and -13.

3x-29=7

Add 29 to both sides.

3x = 36

Divide 3 from both sides.

x = 12
Answer Link

Otras preguntas

blank thousands equals 1800 tens
What happens as genes are passed on from parent to offspring over many generations?
7) At Elisa's Printing Company LLC there are two kinds of printing presses: Model A which can print 70 books per day and Model B which can print 55 books per da
people involved in cases that are accepted by the us supreme court must travel to washinton dc?
Suppose scientists found parts of the DNA from a dinosaur. What info would this discovery provide? What info would it not give them?
Which situation CANNOT be represented by this equation? -1\4x + 14 = 8 A) A hot-air balloon has a 14-foot diameter that each 1\4 of an hour gets steadily smal
what is thunder is cause by?
What is the most common cause of liver failure ?
A 15.6 grams of ethanol absorb 868 J as it is heated. The initial temperature is 21.5 degrees Celsius. What is the final temperature if the specific heat of eth
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC