bipina702 bipina702

26-02-2021
English

contestada

write a letter of condolence to your friend who has lost his/her mother

Respuesta :

laurenn157 laurenn157

26-02-2021

Dear friend (whatever name you want), I want to send my deepest condolences to you and your family during this time. Your mother was an amazing woman and she will truly be missed. If there’s anything you need i’m here for you.

Answer Link

Otras preguntas

how did the Meredith March Against Fear reveal splits in the Civil rights Movement

By who is the president elected?

Determine the amplitude or period as requested. Period of y = 4sin 1/3x a. 4 b. Pi/4 c. 4pi/3 d. 6pi

When earth and moon are separated by a distance of 3. 84.

12 A train in France can travel at a speed of 217.4 miles per hour. A train in China can travel 1.23 times this speed. How fast can the train in China travel in

1. My sister and I talked with each other a lot when we were young (used)

Three cubes each of side 3 cm each are joined end to end. Find the surface area of the resultant solid.

how was the founder of connecitcut

what is the most common goal of a trade agreement?

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):