livbalinton livbalinton
  • 23-03-2021
  • Mathematics
contestada

4. On a 3-hour trip, a car travels 156 miles.
What is the average speed of the car on this
trip?

Respuesta :

Muscardinus Muscardinus
  • 28-03-2021

Answer:

v = 52 mph

Step-by-step explanation:

Given that,

The distance travelled by the car, d = 156 miles

Time, t = 3 hour

We need to find the average speed of the car. The formula for the average speed is given by :

[tex]v=\dfrac{d}{t}\\\\v=\dfrac{156}{3}\\\\v=52\ mph[/tex]

So, the average speed of the car is equal to 52 mph.

Answer Link

Otras preguntas

which one of the statements is true
Lexington County Army Air Base in Columbia South Carolina bears the distinction of being one of the training sites for A) the Tuskegee Airmen. B) Doolittle
Which of the following ideas best fits with biological evolution by natural selection? 1.The most fit individuals are those with the highest reproductive succes
why did the united states fail to join the league of nations
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Does “actions speak louder than words” refer to leadership, mentoring, or teaching by example?
Siri has half the amount of quarts in a gallon how many cups are in those quarts if there are 4 quarts in a gallon
Find the mean of these values 6,4,8,2,5
plot and steps for writing a comedy please!!!
Describe two ways in which bacteria and the fungus Penicillium are similar? Describe two ways in which bacteria and the fungus Penicillium are different?