Ekimock88 Ekimock88

23-03-2021
Mathematics

contestada

Solve
y = -22t² when t = 5

If you show your work I will give you branist

Respuesta :

loganlolokelly loganlolokelly

23-03-2021

Y= -550
T=5
Ejejdhdhdudhdbdhfjf
Fjdhdheje

Answer Link

jiggyjay757 jiggyjay757

23-03-2021

-22(5)^2
-22 x 5^2 = -550

Answer Link

Otras preguntas

The graph of y= f(x) is shown below. Find the value of f(−1).

Mark and Heather Starr are celebrating their 25th anniversary by having a reception at a local reception hall. They have budgeted $2,500 for their reception. if

Last month we went on holiday to South Island, New Zealand.

Vibrio cholerae is an aerobic, non-spore-forming, gram-negative, bacillus. what does the aforementioned description tell you about the cell wall composition of

Solve 2 + 1/6y =3x + 4

Jeremy determines that √9= 9^1/2. Part of his work is shown √9=3=3^1=3^1/2 + ^1/2=____=9^1/2 Which expression or equation should be placed in the blank to corre

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I

Cuánto vale 20 litros de leche si 1litro vale 4?

pleeeeeeease help me

What does this story teach readers about the acquisition of wisdom? In other words, when will Sandel learn to be a more thoughtful and economic fighter like Tom