studentinquiry studentinquiry
  • 23-03-2021
  • Biology
contestada

2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’.

template DNA 3’ CCTACGGTTCGTACCCCGTATGTGTAACTTGTCAT 5’

Respuesta :

181103
181103 181103
  • 23-03-2021

Answer:

DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’.

Explanation:

Answer Link

Otras preguntas

What was true of the Radical Republicans' plan for the South?
Which is bigger 5.6 repeating or 17/3
0.24 in two equivalent forms
How has censorship affected democratic growth in Russia? A) The freedom of speech granted in the constitution has been repressed B) Private business has become
what is the answer for 7x minus x
Ronald Reagan served the Screen Actors Guild in what capacities? principal liaison member of board of directors president public relations officer
What did England and the English settlers really want from colonization? National Glory? Wealth? Adventure? A solution to social tensions?
On the number line, between what two consecutive whole numbers is square root 54
À quelle heure est-ce que tu te couches?
How does the color of water affect its evaporation rate