tanyasingh21 tanyasingh21

26-03-2021
Biology

contestada

Help me plz asap 2-4 plz

Help me plz asap 24 plz class=

Respuesta :

annaclaire946 annaclaire946

26-03-2021

Answer:

1.mRNA- ATGAAAAGGTCCGTGGGAACTAAACAACACTAA

2.MRNA- ATGAAAACGGTCCGTGGGAACTAAACAACACTAA

3. ??

4. It will affect the protein so the leg wont have enough protein or have too much.

Explanation:

Answer Link

Otras preguntas

What are the prepositions in the following sentence? Select the four that apply. Cassidy drove around the block for several minutes while her friends returned c

Evaluate the expression 6a - 2b when a = 5, b=7

Para que con exactitud se pueda poner líquido en dos tambos de 60 y 90 litros, respectivamente, ¿Cuál es la capacidad máxima en litros que debe tener el recipie

reflective thought about Jean Piaget of his theory of self??

Which statement BEST captures the importance of good personal hygiene? A. Your hygiene only affects your physical health. B. Good hygiene habits are only import

When Bolivar uses the term "monsters," who is he discussing?

la población envejecida puede causarle problemas a un país por qué

Identify two segments that are marked parallel to each other on the diagram below.(diagram is not to scale)

What are the warnings about the effects of Medicine Misuse and Abuse?

Tan x = square root of 3