6izzggwb8y 6izzggwb8y

23-04-2021
English

contestada

Why did Shakespeare get married

Respuesta :

DrippQueenMo DrippQueenMo

23-04-2021

Answer:

He was forced to.

Explanation:

He was immediately forced by Hathaway's family to marry their pregnant relative.

Answer Link

Otras preguntas

What was the effect of the Stamp Act ?

Which environmental factor would likely lead to an increase in genetic variation in a population of squirrels? A.an increase in predators B.an increase in avail

The speakerlistenermoderatoroverseer of a discussion keeps the group on track.

What is the value of x? Question 8 options: 6 6√2 12 12√2

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

You buy 6 pounds of apples for $33. What is the cost of 10 pounds of apples?

Kate earns $6 per hour babysitting. She made this table to show the relationship between the number of hours she works (x) and the amount of money she earns in

Explain how Hanna Senesh's choice of words in her poem “One, Two, Three” might suggest an indecisive tone. Use examples from the poem to support your answer.

An artist mixes paint to make new colors. She uses 1/3 cup of red paint 1/3 cup of yellow paint to make a batch of orange paint. If the artist has 2 cups of

There are 11 different actor auditioning for the roles of Larry, Curly, and Moe. How many ways could the roles be cast?