ibrahimukalimanzila ibrahimukalimanzila

26-04-2021
Mathematics

contestada

it taken 12 days for 10 men assemble a machine how long could it take for 15 men to assemble the machine?

Respuesta :

26-04-2021

It will take 17 men to assemble a machine

Answer Link

Otras preguntas

A cylindrical can of cat food has a diameter of 3.5 inches and a height of 1.25 inches A second brand of cat food is packaged in a cylindrical can with a radius

6. Why is crossing over, or recombination, in meiosis a genetic advantage for a n organism? Why is crossing over an advantage for a geneticist

help answer ASAPPP 10 points

what feature of a confederal system did the confederate states of america most want

182,886 rounded to the nearest tenth

Why does Vivien say that she “shan't tell” Lancelot’s identity to her friend in King Arthur's Socks: A Comedy in One Act?

Which muscle below is a 2nd class lever? A) Gastrocnemius B) Biceps Brachii C) Flexor carpi ulnaris D) Extensor carpi ulnaris

Water harvesting, the collection of rainfall and run off for future use, has been practiced for thousands of years; but in some regions where it was previously

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

How can global warming lead to changes to the Earth’s surface? a. Global warming can lead to an increased number of earthquakes, which change the Earth’s surfac