chayalem
chayalem chayalem
  • 24-08-2021
  • Mathematics
contestada

How do you do a negative power?

Respuesta :

sampherdz
sampherdz sampherdz
  • 24-08-2021

Negative multiplied by negative is positive

Answer Link
Annyohasayo
Annyohasayo Annyohasayo
  • 24-08-2021

Answer:

A negative exponent is defined as the multiplicative inverse of the base, raised to the power which is opposite to the given power. In simple words, we write the reciprocal of the number and then solve it like positive exponents. For example, (2/3)-2 can be written as (3/2)2.

Step-by-step explanation:

please mark me brainliest

Answer Link

Otras preguntas

what is common to nuclear fission?
why is it difficult to find happiness? help pls​
sally had 224 dollars to spend on 8 books After buying them she had 16 dollars. How much did each book cost?
Do sea stars feed on mollusks by using the suction power of their tube feet?
a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
What was the most important message that BTS taught you personally?I think it was definitely to be more confident in myself and not care about what people think
3(2 + x) = 5(x + 6) O x=-17 O x=-12 no solution O x=-10
Solve: 5n + (3 x 4) n= 6 *
Factor. x^3-27 help!!!!
what's the purpose of the Tea Act?