jkspreadbury jkspreadbury
  • 21-10-2021
  • Chemistry
contestada

How many moles of Oz would be required to generate 13.0 mol of NO2
in the reaction below assuming the reaction has only 74.1% yield?
2 NO (g) + O2 (g) → 2 NO2 (g)

Respuesta :

Dijdkdkdkdkdkdkkfkf
Dijdkdkdkdkdkdkkfkf Dijdkdkdkdkdkdkkfkf
  • 21-10-2021

Answer:32

Explanation:

Have a nice day :)

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
The term racial unconscious means that
What role does the media play in reporting human rights violations in the right manner
the most important benefit a dificult amendment process is that it
What type of triangle is this?
Does “actions speak louder than words” refer to leadership, mentoring, or teaching by example?
what number should be added to the expression to turn it into a perfect square trinomial x^2+2x
what procedure could you use to test the effect of a catalyst on a reaction
Describe two ways in which bacteria and the fungus Penicillium are similar? Describe two ways in which bacteria and the fungus Penicillium are different?
what number must you add to the polynomial below to complete the square? x^2-x A. 1/4 B. 1/2 C. 2 D. 1