23-10-2021
Mathematics

contestada

Solve for X Please show your work.
(x+3)/(x^2-9)=(2x+7)/(x^2+2x-15)

Thank you

Respuesta :

bravo49587 bravo49587

23-10-2021

The answer is X=-2, explanation in the picture.

Ver imagen bravo49587

Answer Link

Otras preguntas

Can anyone help me to answer this question, thank you very much

Tryouts Kayla tried to ignore her sore throat and stuffy nose. She was trying out for the soccer team, and Coach Markham would pick only the twenty best players

This is an image of the ...................... Topology. * If you get it right i will mark you brainlist

Which West-coast town experienced a major fire during the mid-1800's? A. Los Angeles B. Seattle C. San Diego D. San Francisco

Write a paragraph in the present tense in which a character discovers something dangerous. For example: a) a poisonous snake or spider b) a damaged bridge ov

Help help help help history

“If this wild project succeeds, under the auspices of Thomas Jefferson, President of the United States, and three hundred thousand slaves are set free in Virgin

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Help me plzzzzz Speaking in 2 min Describe something you can do to help protect the environment

3 1/3 of it is 10 I need help!