angelinalouis
angelinalouis angelinalouis
  • 24-10-2021
  • Mathematics
contestada

Plz, can anyone answer this question

Plz can anyone answer this question class=

Respuesta :

christinehopebarredo
christinehopebarredo christinehopebarredo
  • 24-10-2021
1iii
2b
3a
4e
Hope it helps pls add brainlist if you want your answers to be correct or...... not.... ;)
Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Question 16 of 20 Select the best answer for the question. 16. Which of these federal policing agencies is part of the U.S. Department of the Treasury?
I need help please what are some negative effects of stress on an individual? For this discussion, I would like everyone to explain how stress affects an indivi
Can anyone help? My teacher just briefly went over this in notes and I can't really decipher between physical and chemical changes in the examples
Which verb form correctly completes the sentence? Is the verb singular or plural? The boy with the red shirt and blue jeans __________ been his friend since h
7.8 14. Give the inequality 7.9 15. Make d the subject of the formula: A cd Anyone know the answers to these two questions?
What's x² + 2x + 1 factorised?
Cardiac muscle contracts A. in response to voluntary output B in response to nonvoluntary input C. on its own without input
suppose you were to grind the up and homogenate a pancreas. Do you think it would be possible to isolate insulin from this homogenate?
is gravity a field force