aniyahibbott aniyahibbott

24-11-2021
Mathematics

contestada

6 two the second power+(59-4) divided by 11)×2

Respuesta :

jcherry99 jcherry99

24-11-2021

Answer:

Step-by-step explanation:

6^2+ (59 - 4 ) = 36 + 55 = 91

I'm taking this to mean 11*2 If I am wrong leave a note.

11*2 = 22

91 / 22 = 4.14

Answer Link

Otras preguntas

Write the base sequence of the complementary strand of double-helical DNA in which one strand has the sequence (5)ATGCGTAGCCTAGCCTAGTAGCCTTC(3). What is RNA seq

When Bread and Butter Bakers got the newest batch of flour, they noticed a price increase of $1.00 per pound of flour (double their old price!). Bread and Butte

What does 3x+2+x-4 equal?

4x+5=45 (Show work to get brainliest) A) 5 B) 10 C) 15 D) 20

Answers to A) b) & c)

A 0.450-kg hockey puck, moving east with a speed of 5.80 m/s, has a head-on collision with a 0.900-kg puck initially at rest. Assuming a perfectly elastic colli

Which function is the inverse of f(x) = 2x+3? or(x) = -x- F(x) = x - r1(x) = –2x+3 or(x) = 2x + 3

In the laboratory, cancer cells fail to show density-dependent inhibition of growth in cell culture. What is one explanation that could account for this?

The Renaissance motet is Select one: A. piece for several solo voices set to a short poem, usually about love B. dancelike song for several solo voices. C. A po

Consider the following statement: Romanticism is all about romantic love. Is this statement true or false?