blessing10936777
blessing10936777 blessing10936777
  • 24-02-2022
  • English
contestada

Main function of a conjunction

Respuesta :

queenofhearts123
queenofhearts123 queenofhearts123
  • 01-03-2022

A conjunction is a part of speech that functions as a connector between two sentences, clauses, phrases, or words. We often use conjunctions in speech without realizing it. In writing, they can be effectively used in lieu of starting a new sentence.

Answer Link

Otras preguntas

Distinguish between eukaryotic and prokaryotic binary fission.
Animals with cephalization usually have Select one: A. radial symmetry B. only 2 germ layers C. bilateral symmetry D. a digestive cavity with a single opening
Use these words in a sentence proton neutron and isotope
how to solve these question?
In a recent year, certain colleges and universities received about $268 million in aid. Ten years later, they received about $94 million. Find the percent of ch
Multiple sclerosis is a demyelinating disease in which the patient's immune system attacks and destroys the cells that form the myelin sheath in the central ner
What impact did Babe Ruth have on the society/country?
What is double consciousness
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Animals with cephalization usually have Select one: A. radial symmetry B. only 2 germ layers C. bilateral symmetry D. a digestive cavity with a single opening