jasminequeen392 jasminequeen392

24-01-2017
French

contestada

In 1821, what was the problem Mexican leaders had with Texas? How did they deal with it?

Respuesta :

ryanskelton1 ryanskelton1

24-01-2017

they started a war and pushed them out

Answer Link

Otras preguntas

What happens if the hydrogen pumps in photosystems l and ll are not working correctly

Please Help I Will Mark Brainly !!! Please

In 1775, the Continental Congress created a department to deal with Native American people. What was it called?

Help me I don’t understand.Brainliest and 30 points

DNA tacaggtacccgaacccaattta

What’s the answer???

graph inequality on the coordinate plane.5x-y=-2

Which of the following items is an example of a sustainable agriculture practice?A. Subsistence farming on a fragile ecosystemB. Large-scale cattle farmingC. Sl

!!PLEASE ANSWER ASAP!! you put a screw in a wall stud with a screw driver. then you put a screw in the wall with an electric screw driver. which of the follow

PLEASE ANSWERRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR