alizabeth2
alizabeth2 alizabeth2
  • 23-02-2017
  • Mathematics
contestada

what is the quotient of 20 divided by one fourth

Respuesta :

bsjsjsdjjd
bsjsjsdjjd bsjsjsdjjd
  • 23-02-2017
80 is the answer to that
Answer Link
yoosungkim
yoosungkim yoosungkim
  • 23-02-2017
20 divided by 1/4 is 80
Answer Link

Otras preguntas

A committe will be visiting America................ November 10............... 8'oclock............... the afternoon 1.in-at-in 2. in-at-on 3.on-in-at 4.on-at-i
Based on the description that follows how many potential.
I need help on math true and false please
Dont know how to calculate it
Hope everyone had a great day!​
A moneylender’s income decreased by $60 When the rate of interest dropped from 8% per annum to 7 3/4 % per annum . What was his principal?
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
The diameters of a circle is 7m. Find its area to the nearest tenth?? Help please
Stylistically, why would the author go into detail on all types of discrimination and then state simply "It all started on a bus?" a. The author wants to show t
Using supporting evidence, what makes Macavity a “Mystery Cat”? Cite/quote TWO different lines from the poem that clearly develop this central idea. “Macavit