judyvilla
judyvilla judyvilla
  • 26-02-2017
  • Mathematics
contestada

At 15 mins you burn with a uv rating of 6 what would it be at uv 10

Respuesta :

Аноним Аноним
  • 26-02-2017
you can set up a proportion

15 mins / 6 uv = x / 10 uv

Cross multiply

15 x 10 = 150

6 x X = 6x

150 = 6x

divide by 6

x = 25

So, as 25 minutes, the uv is 10
Answer Link
playerawesome1
playerawesome1 playerawesome1
  • 26-02-2017
First you multiple 15 by 10 and you get 150 and then you Divide 150 by 6 and you get 25. So at a uv rating of 10 it will take you 10 minutes
Answer Link

Otras preguntas

how did the use of slavery increase wealth??
the number of protons in an atom is equal to the number of
What is your first draft idea for a theme in the lightning thief related to a struggle for power?
The chemical reaction that occurs when gasoline and air are ignited is called a(n) ____.
When Peter ate lunch at a restaurant, his food bill was $13.25. The sales tax rate was 6%. Peter left a 20% tip for the server. How much did Peter pay altogethe
What type of verbal appears in the sentence? To win a game of chess you must capture a trap the other king.A. Past participleB. Present participleC. Adverb infi
the sum of two number is 14 and their difference is 10 then what will be their multiplication
PLEASE HELP ASAP!!! CORRECT ANSWER ONLY PLEASE!!! I CANNOT RETAKE THIS!! Jack wrote this solution to solve for x. Which statement is true?
DNA tacaggtacccgaacccaattta
What is natural increase?What can it tell us about a country?