Seudónimo Seudónimo
  • 22-03-2017
  • Mathematics
contestada

PLEASE HELP!!! Solve for y.

PLEASE HELP Solve for y class=

Respuesta :

gortisonottaco
gortisonottaco gortisonottaco
  • 22-03-2017
y equals .11

Hope this helps!
Answer Link
Аноним Аноним
  • 22-03-2017
-6y - 5/3 = (5/4)y - 5/2
-72y - 20 = 15y - 30 - multiply everything by 12 to get rid of the fraction
-72y = 15y - 10 - add 20 to both sides
-87y = -10 - subtract 15y from both sides
y = 10/87 - divide both sides by 87
Answer Link

Otras preguntas

people involved in cases that are accepted by the us supreme court must travel to washinton dc?
HELP ASAP!!!!!!!! PLEASE!!!!!! Why does Ralph become the leader of the group at the beginning of the novel? A. because Ralph is manipulative and po
If y= 4x +5 has a gradient of 4 write the equation of a line parrellel to it?
What is the answer to 8xsquared-24x
Why does Vivien say that she “shan't tell” Lancelot’s identity to her friend in King Arthur's Socks: A Comedy in One Act?
why did the united states fail to join the league of nations
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
write a sentence with the word labyrinth
What educational level, age and econimic status of the audience do I reach when talking bout geriatric offices
The price of a new car is 16000$ Mr Mar paid 15% of the price as a down payment how much does he still owe? (Please help and explain)