jewitcraft jewitcraft

24-03-2017
Mathematics

contestada

What would the range be of this function? I found the domain

What would the range be of this function I found the domain class=

Respuesta :

aprilhall aprilhall

24-03-2017

The range is [tex]1 \leq y[/tex]

Answer Link

Otras preguntas

In computer security, compromised computers that act under the direction of an external master computer are referred to as ________.

Give a double integral in terms of a y-simple region which computes the volume of a cylinder of height 3 and radius 2.(You do not need to evaluate the integral)

4. PCR Primer design (4 points) You have a piece of DNA that includes the sequence: 5'GATGAGGATGAGGAGAAGTACCGGCCGCCGCCTGCGCATCACAATATGTTCAGT 3' To amplify this

Gas bubbles are kept from escaping when magma has high ___________

Which one of the following is not an example of the consequences of chronic exposure?a. Over a period of 30 years, workers at a fur felt hat company are exposed

What are the zeros in 6x^3+5x^2+4x+1

A particle in a three-dimensional potential has the wavefunction: () = { 0 o 0 ≤ ≤ {√3 3 3 o > what is the expectation value of r for the particle in t

Hannah purchased three items at the store for $7.05, $8.12, and $3.97. She paid for her items with a $50 bill. Which most closely estimates the change Hannah sh

What is the value of this expression? $-10+(-20)+(-17)-30=$ :

Round answers to the tenths place