ashleyz1121 ashleyz1121

26-04-2017
Mathematics

contestada

The expression ( cot^2x/1-sin^2x is equivalent to ??

Respuesta :

tuandbsk tuandbsk

26-04-2017

Do you mean: cot²x/(1-sin²x) ?
If yes, my answer is: 1/sin²x
Because: cot²x=1/sin²x-1=(1-sin²x)/sin²x
So, cot²x/(1-sin²x) = (1-sin²x)/sin²x.(1-sin²x)=1/sin²x
(sin²x≠1)

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

182,886 rounded to the nearest tenth

In a recent year, certain colleges and universities received about $268 million in aid. Ten years later, they received about $94 million. Find the percent of ch

Please help me with this Imma on a time limit

Becca had 13/15 of a yard of ribbon to use for her crafts projects. She used 3/7 of a yard to make a bow. How much ribbon, r, does Becca have left? Set up an e

statement and reasons m<1 +m<2+ m<3=180 whats the reason?

Imagine a situation in which the number of urea leak channels increased dramatically in the ascending limb of the loop of Henle. What could be one likely conseq

Females with the genotype X^CBX^cb (heterozygous for the red-green colorblindness allele) are rarely colorblind although some have only partial color vision. Sp

1+4=52+5=123+6=218+11=?

If it takes 41.72 J to he a piece of gold waiting 18.69 g from 10.0°C to 27°C what is the specific heat of gold