jadeneica0rmacharra jadeneica0rmacharra

21-05-2017
History

contestada

The french were the first of the europeans to find a permanent settlement in the us. (1 point
a. True
b. False

Respuesta :

30-05-2017

The answer to this would be false

Answer Link

kc1wolden kc1wolden

23-05-2020

Answer:

false

Explanation:

i took the test and its false

Answer Link

Otras preguntas

what percent of 137.4 is 96

Which situation CANNOT be represented by this equation? -1\4x + 14 = 8 A) A hot-air balloon has a 14-foot diameter that each 1\4 of an hour gets steadily smal

1.True or false: It may be possible to save a significant proportion of Earth's biological diversity by establishing sustainable biological reserves at 25 locat

Which statement is true for single-celled organisms

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Discuss at least two effects on U.S. citizens that stem from the division of power between the federal and state governments.

which of the following statements about taxes is FALSE? A-Taxes are collected a the local, state and federal level. B-Some states don't collect income tax. C-So

Identify your human rights violation and explain in a introductory paragraph why you choose the specific human rights

im making a poster for chemistry. the topic is acid and base. i have to make a creative title to go with the poster. any ideas?

Fred has an extremly rare autosomal recessive disease, so what is the chance that both of his grandfathers are carriers? Our teacher said this homework assignme