cmikhail5673 cmikhail5673
  • 24-08-2017
  • Biology
contestada

Prophylactic rifampin is indicated for individuals in close contact with patients infected by

Respuesta :

LeChatNoir
LeChatNoir LeChatNoir
  • 24-08-2017
Prophylactic rifampin is indicated for individuals in close contact with patients infected by Neisseria Meningitidis or Haemophilus Influenzae.
Answer Link

Otras preguntas

Circle the preposition in these sentences We were exhausted because our flight arrived at 4am.
what's the possibility of choosing a spade in a deck of 52 cards?
A red dwarf is _____ A. the remains of a supernova. B. a hot pulsar. C
What might "tangible artifacts" tell us about the Shang?
Is sextillion a real number?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
A problem play focuses on what exactly? Select all that apply. 1. problems in the author's life 2. problems in society 3. problems in life that haven't yet occ
If 1+4=5; 2+5=12; 3+6==21; what is 8+11
1.Why is the coding sequence (whether DNA or RNA) at least three times as long as the protein sequence it codes for? 2.How can the DNA sequence be so different
If 1+4=5; 2+5=12; 3+6==21; what is 8+11