summer191
summer191 summer191
  • 25-10-2017
  • History
contestada

How did England try to replenish its empty treasury after the French and Indian war

Respuesta :

jimhelm21 jimhelm21
  • 25-10-2017
The British Parliament raised taxes on the colonists. The Sugar Act, The Stamp Act, and The Townshend Acts are some examples.
Answer Link
Аноним Аноним
  • 11-10-2018

Parliament passed a series of acts trying to raise money through various taxes on the colonists.

Hope this helps :)

Answer Link

Otras preguntas

DNA tacaggtacccgaacccaattta
Which amendment cover more than one right
how to complete a coordinates table
what is a key element in democracy? - self determination -selfishness -violent -heredity
Think about your displacement at three different times throughout your day and compare it with e distance you traveled. (6 points)
Who of these should be used to find the date and time of the homecoming parade? A)term calendar B)Weekly Planner C)Daily Organizer D)None of these
DNA in the nucleus is found in structures called _____. organelles pores ribosomes chromosomes
I need 1-5. Please help!!!
Which of the following is an example of positive acceleration? A boy running from his house around the block and ending up back home. A car slowing down as
What is the answer to this? And I would like if anyone else could explain how they got the answer for me to understand.