croitru7857 croitru7857
  • 25-02-2018
  • Biology
contestada

The base sequence of the template strand of dna is cattggtaggcaaaagaact. what is the new synthesized complementary strand?

Respuesta :

Eric0422 Eric0422
  • 25-02-2018
gtaaccatccgttttcttga
Answer Link

Otras preguntas

The Lees have 3 children. The oldest is twice as old as the youngest. The middle is 5 years older than the youngest. If the sum of the age is 57, how old is eac
What is the simplest form of the expression 6x(x − 4) − 16x2 − (9x − 1)
How much times does 7 go into 17?
What is the average of something (mean or mode) I really need to know I forgot what the difference was ho
What is a summary number model :) by the way here is the question joe ordered 72 plants for his patio garden. Each pot holds 4 plants.how many pots are needed t
how many moles are in 9.8 grams of calcium?
What is the average of something (mean or mode) I really need to know I forgot what the difference was ho
What was the role of the proprietors in the middle colonies
What is it called when two ratios have the same value when simplified?
name and describe the cell structure that helps prevent damage to certain cells when they are subjected to high osmotic pressure