XXTENTICXX XXTENTICXX
  • 27-04-2018
  • Mathematics
contestada

Please help me! I’m crying.

Please help me Im crying class=

Respuesta :

datgamer13
datgamer13 datgamer13
  • 27-04-2018
The answer to the first question is D 60.

The answer to the second question is C 0.41.
Answer Link
fallenangel3883
fallenangel3883 fallenangel3883
  • 27-04-2018
3) 5*4*3=20*3=60
4) 41/100= 41 hundredths or 0.41
Answer Link

Otras preguntas

The spread of ideas during the Renaissance was MOST affected by. A) luthers religious conversion. B) the support of the Catho
how many atoms are present in 4.0 mol of sodium
Can someone help me with this problem... #20
blank thousands equals 1800 tens
Which best describes the climax of the Odyssey? A. Odysseus kisses the ground as his journey home comes to an end. B. Odysseus sees Telemachus for the fir
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Approximately, where do the numbers in the first file go in the second file's number line?If possible, post a number line like mine onto your answer and make ar
Color ___ indicates that one color is dominating a picture.
1+4=5 2+5=12 3+6=21 8+11=
“Just a matter of colouring...or lack of it. It is only a question of getting used to. Who is to say this colour is right and that is not?” Who is the speaker o