imilinyg0oali8dideaj imilinyg0oali8dideaj
  • 24-04-2017
  • Geography
contestada

Which is more destructive -hurricanes or tornadoes?

Respuesta :

Equanimity
Equanimity Equanimity
  • 24-04-2017
Hurricanes;
They have a higher wind speed and are much larger. This causes more destruction.
Answer Link

Otras preguntas

What is the 1st operation that is calculated in a formula?
A Dodecahedron (12 sided die) is thrown, what is the P( odd OR a number greater than 6)?
How does the text describe the relationship between the Nicoleno people and the Franciscan priests? Question 3 options: They didn't understand each other. The N
You can self-critique your art ___________ you want. however as many times as wherever whenever
What is the area of the rectangle above? A. 72 square units B. 66 square units C. 17 square units D. 34 square units
si pesa 100kg cuánto pensaría se eliminará todo el agua​
Sam scored 85% on his math test. If his score is 17, how many points were on the test?
just number 4 pls (i need 20 characters to post this)
How does the carnivorous plant catch its victums?
2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTA